davis lab > projects > genome-wide RNAi

davis lab site graphical menu (text links at bottom of page)

davis lab > projects >

next project >

The Wee-P Protein Trap:
Tagging Proteins With GFP at Their Native Genomic Loci

I.	Introduction
II.	Methods
III.	Using Wee-Ps in P-element replacement experiments
IV.	Table of available fusion lines
V.	Table of expression patterns and images for Wee-P lines whose gene has not been determined

IV. Table of available fusions

Line #	CG #	Gene name	Location	WeeP 3' end flanking genomic sequence	Fusion type
WeeP1 (see note 1)	CG4264	Hsc-70-4	88E8-9	gatccagcattgatcttgccattttcatgaatcgg	Internal
WeeP2 (see note 2)	CG3660	kismet	21B3-4	approx.: gaagtcgatgctctctctgtcgctctccctta	Internal
WeeP3	CG4944	ciboulot	4B1	gggtatcgcagactacaaatattgcagtcgaggaac	N-terminal
WeeP4	CG9539	sec61 alpha	26D4-7	gtcttatacgtgtgtttttccgagcgaatctcgcttt	Internal
WeeP5	CG14066	larp	98C3	gggcagaggcggatgagcgaaacaagaggcgga	N-terminal
WeeP6	CG9748	belle	85A5-8	cacgcgtctgaaagcggaaaaaaacgtgaa	N-terminal
WeeP20-CyO (see note 3)	CG9894	CG9894	23A7-B1	tttacagtgctgcggattcagatgctctctctc	Internal
WeeP25 (see note 4)	CG9983	Hrb98DE	98D3-4	gtctcgtgtgtcaggggactttctccattt	N-terminal
WeeP26	CG17927	Mhc	36A8-9	agggagtgctagtcgtactcgttatcgtttctatcccgtg	Internal
WeeP27	CG4898	tropomyosinI	88E9-12	gcagagtgcttcttcagtcaagaaaaaatcgagctcaagtg	Internal
WeeP28	CG17489	Yip6	ND	approx.:aaggaaacttatcaacttaatatcgaaaataaataattct	N-terminal
WeeP49	CG9894	CG9894	23A7-B1	gtccggcaatcaaagattattgttgttaggttcaaatcgagg	Internal
WeeP59	CG5119	Pabp2	44A7-8	approx.: acgccttgcgaaagccgccgaattccctg	Internal
WeeP103	CG9748	belle	85A5-8	ttgcgcctctctctatctgtgtattccggaga	internal
WeeP114	CG8472	Calmodulin	48F8-10	gttcgtccgcttcggtcgttcattcg	N-terminal
WeeP118	CG6692	Cp1	50D2-3	gattgggctctcatttcgatttcggcgat	Internal
WeeP153	CG6146	Topoisomerase1	13B6	gccgaggcagacgaaatgtatttggcac	Internal
WeeP157	CG7970	CG7970	65A5	NA	N-terminal
WeeP159	CG4609	fax	72E5-F1	gtgacctgccctgccccgtaactgaaaaggga	Internal
WeeP181-CyO (see note 5)	CG15792	zipper	60E11-12	approx.: tcccttttgaaactctcgcctctctctgtt	Internal
WeeP184	CG6084	CG6084	68C13	atgcttctttccatttctaagcacaacacaatttatt	Internal
WeeP197 (see note 6)	CG7727	Appl	1B10	ttacagaccaactagcacttgcgttcctatgc	ND
WeeP209	ND	SD27140	ND	approx.: cgcagacacgcatccaagacgggaagagccgaag	N-terminal
WeeP212 (see note 7)	CG6058	Akd	97A2	approx.: agaagccttatcgggtgacttttggctcac	N-terminal
WeeP283 (see note 8)	CG5670	ATPalpa (Na+ ATP pump)	93B	tatccgagaatcgagaaagcttaaccactc	N-terminal
WeeP338	CG7070	Pyruvate Kinase	94A9	ccctggtcgagcatacccttgaatataccc	N-terminal
WeeP345	CG1059	Karybeta 3	82D	gccgaaatttcagacgaattctgattcatcgta	Internal
WeeP382	CG1483	Map205	100E	ttgtcctggggtgcgtcattttggctcgct	Internal
WeeP420 (see note 9)	CG4857	CG4857	4B1	aaatagaccaagcatactgttatctcgttc	Internal
WeeP426 (see note 10)	ND	sanpodo	99F	gtcgagccttatctctcccatatcgagtta	Internal
WeeP438 (see note 11)	CG10199	l(3)82fd	82F8-9	approx.: cgagacttgcttcagcttttttctcc	Internal
WeeP440 (see note 12)	CG3920	CG3920	24C5	cttatacagcacggaattatcgattttttt	N-terminal
WeeP456	CG3988	gamma snap	60B5	tgggacagtgcgaagcagtaaactaaatagc	Internal
WeeP477 (see note 13)	CG3523	fatty acid synthase	23D1	ttcaaacaaaaaacctaatcgcccggcat	N-terminal
WeeP950	CG8714	sut 1	44A4-6	atctctgcacatgcacattttctttgtt	Internal
WeeP1501 (see note 14)	CG9277	Beta tubulin 56D	56D7-8	tcagccattttaggttaaaatgacgtcatgttt	Internal

Notes:

1. Chromosome has second site lethal.

2. We have 2 separate fusions for Kismet. WeeP2 is inserted as listed in the "Flanking sequence" column. WeeP2a is inserted elsewhere and may actually tag a different isoform. The flanking sequence for WeeP2a is: gtccaagtgctcgtggaaactcgatgcaa

3. WeeP is on CyO chromosome. This is an excellent GFP+ balancer as it lights up all nuclei and thus can be distinguished from the other more widespread CyO-GFP balancer. Another CG9894 fusion that is not on a CyO balancer is available in WeeP49.

4. WeeP is on Dr chromosome.

5. WeeP is on CyO chromosome.

6. GFP-Appl proteins appear to be stuck in ER. Unbalanced stock.

7. Unbalanced stock

8. Not clear which isoforms are tagged

9. Unbalanced stock

10. Tags only Alt 1 isoform. There may be some confusion in the literature about a "sanpodo" phenotype that was incorrectly assigned to the actin binding gene, and thus the actin binding gene at 99F may not be eventually called sanpodo. Nevertheless, WeeP 426 tags the actin binding gene at 99F.

11. The l(3)82Fd locus is complex, with at least 9 isoforms. WeeP438 may tag as little as only 1 isoform (CG32464-RC) or as much as 8 isoforms (all but CG32464-RH). Unbalanced stock

12. Unbalanced stock

13. Unbalanced stock

14. May tag only two isoforms, unbalanced stock

Return to Top

< project index

The Wee-P Protein Trap: Tagging Proteins With GFP at Their Native Genomic Loci

The Wee-P Protein Trap:
Tagging Proteins With GFP at Their Native Genomic Loci