davis lab projects
davis lab > projects > next project >  

The Wee-P Protein Trap:
Tagging Proteins With GFP at Their Native Genomic Loci

I. Introduction
II. Methods
III. Using Wee-Ps in P-element replacement experiments
IV. Table of available fusion lines
V. Table of expression patterns and images for Wee-P lines whose gene has not been determined

IV. Table of available fusions

Line # CG # Gene name Location WeeP 3' end flanking genomic sequence Fusion type

WeeP1
(see note 1)

CG4264 Hsc-70-4 88E8-9

gatccagcattgatcttgccattttcatgaatcgg

Internal

WeeP2
(see note 2)

CG3660 kismet 21B3-4

approx.: gaagtcgatgctctctctgtcgctctccctta

Internal
WeeP3 CG4944 ciboulot 4B1

gggtatcgcagactacaaatattgcagtcgaggaac

N-terminal
WeeP4 CG9539 sec61 alpha 26D4-7

gtcttatacgtgtgtttttccgagcgaatctcgcttt

Internal
WeeP5 CG14066 larp 98C3

gggcagaggcggatgagcgaaacaagaggcgga

N-terminal

WeeP6

CG9748 belle 85A5-8

cacgcgtctgaaagcggaaaaaaacgtgaa

N-terminal

WeeP20-CyO
(see note 3)

CG9894 CG9894 23A7-B1

tttacagtgctgcggattcagatgctctctctc

Internal

WeeP25
(see note 4)

CG9983 Hrb98DE 98D3-4

gtctcgtgtgtcaggggactttctccattt

N-terminal
WeeP26 CG17927 Mhc 36A8-9

agggagtgctagtcgtactcgttatcgtttctatcccgtg

Internal
WeeP27 CG4898 tropomyosinI 88E9-12

gcagagtgcttcttcagtcaagaaaaaatcgagctcaagtg

Internal
WeeP28 CG17489 Yip6 ND

approx.:aaggaaacttatcaacttaatatcgaaaataaataattct

N-terminal
WeeP49 CG9894 CG9894 23A7-B1

gtccggcaatcaaagattattgttgttaggttcaaatcgagg

Internal
WeeP59 CG5119 Pabp2 44A7-8

approx.: acgccttgcgaaagccgccgaattccctg

Internal
WeeP103 CG9748 belle 85A5-8

ttgcgcctctctctatctgtgtattccggaga

internal
WeeP114 CG8472 Calmodulin 48F8-10 gttcgtccgcttcggtcgttcattcg N-terminal
WeeP118 CG6692 Cp1 50D2-3

gattgggctctcatttcgatttcggcgat

Internal
WeeP153 CG6146 Topoisomerase1 13B6

gccgaggcagacgaaatgtatttggcac

Internal
WeeP157 CG7970 CG7970 65A5 NA N-terminal
WeeP159 CG4609 fax 72E5-F1

gtgacctgccctgccccgtaactgaaaaggga

Internal

WeeP181-CyO
(see note 5)

CG15792 zipper 60E11-12

approx.: tcccttttgaaactctcgcctctctctgtt

Internal
WeeP184 CG6084 CG6084 68C13

atgcttctttccatttctaagcacaacacaatttatt

Internal

WeeP197
(see note 6)

CG7727 Appl 1B10

ttacagaccaactagcacttgcgttcctatgc

ND
WeeP209 ND SD27140 ND

approx.: cgcagacacgcatccaagacgggaagagccgaag

N-terminal

WeeP212
(see note 7)

CG6058 Akd 97A2

approx.: agaagccttatcgggtgacttttggctcac

N-terminal

WeeP283
(see note 8)

CG5670 ATPalpa (Na+ ATP pump) 93B

tatccgagaatcgagaaagcttaaccactc

N-terminal
WeeP338 CG7070 Pyruvate Kinase 94A9

ccctggtcgagcatacccttgaatataccc

N-terminal
WeeP345 CG1059 Karybeta 3 82D

gccgaaatttcagacgaattctgattcatcgta

Internal
WeeP382 CG1483 Map205 100E

ttgtcctggggtgcgtcattttggctcgct

Internal

WeeP420
(see note 9)

CG4857 CG4857 4B1

aaatagaccaagcatactgttatctcgttc

Internal

WeeP426
(see note 10)

ND sanpodo 99F

gtcgagccttatctctcccatatcgagtta

Internal

WeeP438
(see note 11)

CG10199 l(3)82fd 82F8-9

approx.: cgagacttgcttcagcttttttctcc

Internal

WeeP440
(see note 12)

CG3920 CG3920 24C5

cttatacagcacggaattatcgattttttt

N-terminal
WeeP456 CG3988 gamma snap 60B5

tgggacagtgcgaagcagtaaactaaatagc

Internal

WeeP477
(see note 13)

CG3523 fatty acid synthase 23D1

ttcaaacaaaaaacctaatcgcccggcat

N-terminal
WeeP950 CG8714

sut 1

44A4-6

atctctgcacatgcacattttctttgtt

Internal

WeeP1501
(see note 14)

CG9277 Beta tubulin 56D 56D7-8

tcagccattttaggttaaaatgacgtcatgttt

Internal

 

Notes:

1. Chromosome has second site lethal.

2. We have 2 separate fusions for Kismet. WeeP2 is inserted as listed in the "Flanking sequence" column. WeeP2a is inserted elsewhere and may actually tag a different isoform. The flanking sequence for WeeP2a is: gtccaagtgctcgtggaaactcgatgcaa

3. WeeP is on CyO chromosome. This is an excellent GFP+ balancer as it lights up all nuclei and thus can be distinguished from the other more widespread CyO-GFP balancer. Another CG9894 fusion that is not on a CyO balancer is available in WeeP49.

4. WeeP is on Dr chromosome.

5. WeeP is on CyO chromosome.

6. GFP-Appl proteins appear to be stuck in ER. Unbalanced stock.

7. Unbalanced stock

8. Not clear which isoforms are tagged

9. Unbalanced stock

10. Tags only Alt 1 isoform. There may be some confusion in the literature about a "sanpodo" phenotype that was incorrectly assigned to the actin binding gene, and thus the actin binding gene at 99F may not be eventually called sanpodo. Nevertheless, WeeP 426 tags the actin binding gene at 99F.

11. The l(3)82Fd locus is complex, with at least 9 isoforms. WeeP438 may tag as little as only 1 isoform (CG32464-RC) or as much as 8 isoforms (all but CG32464-RH). Unbalanced stock

12. Unbalanced stock

13. Unbalanced stock

14. May tag only two isoforms, unbalanced stock

Return to Top


  project index
davis lab homepage ucsf developmental biology website ucsf cell biology website ucsf neuroscience website ucsf biochemistry website ucsf homepage contact the davis lab davis lab publications davis lab fun davis lab scientific images davis lab people davis lab projects