Herskowitz Lab Protocol
From : RKT 7/96


pNKY51 Sequence (Assemble based on published information):

gaattcagatcttccagtggtgcatgaacgcatgagaaagcccccggaagatcatcttccgggggctttttttttggcgc

gcgatacagaccggttcagacaggataaagaggaacgcagaatgttagacaacacccgcttacgcatagctattcagaaa

tcaggccgtttaagcgatgattcacgagaattgctggcccgctgcggcataaaaattaatttacacactcagcgcctgat

tgcgatggcggaaaacatgccgattgatatcctgcgcgtgcgtgatgatgacattccgggtctggtaatggatggcgtgg

tcgatctcggtattatcggcgaaaacgtgctggaagaagagctactcaaccgccgcgcacagggcgaagatccacgctat

ttaaccctgcgccgtcttgacttcggcggctgccgtttatcgctggcaacaccggttgacgaagcctgggacggcccggc

cgcgctggacggtaaacgtatcgctacctcatatccgcacctcctcaaacgctacctcgaccagaaaggcgtctctttta

aatcgtgtctgttaaatggttctgtcgaagtcgcgccgcgcgcggggctggccgacgctatctgcgatttggtctctacc

ggcgcgacgcttgaagctaacggcctgcgtgaagtcgaagttatctaccgctctaaagcctgtctgattcagcgcgacgg

tgagatggcacagagcaagcaagagctgatcgataaattgctgacccgtattcagggcgtgattcaggcgcgcgaatcga

aatacatcatgatgcacgcgccaagtgaacgcctggaagaggttatcgccctgctgccaggcgccgaaaggccgacaatt

ctgccgctggcaggcgagcaacagcgcgtggcgatgcacatggtcagcagcgaaacgttgttctgggaaaccatggagaa

actgaaagcgcttggcgccagctcgattctggtactgccgatcgagaagatgatggagtgatctgacgcctgatggcgct

gcgcttatcaggcctacgtaatgcgttgatattttgggttctgtaggccggataaggcggaaccctgtgatggagtaaag

accatgagcttcaataccctgattgactggaacagggatctgaattaattctcatgtttgacagcttatcatcgataagc

ttttcaattcaattcatcattttttttttattcttttttttgatttcggtttctttgaaatttttttgattcggtaatct

ccgaacagaaggaagaacgaaggaaggagcacagacttagattggtatatatacgcatatgtagtgttgaagaaacatga

aattgcccagtattcttaacccaactgcacagaacaaaaacctgcaggaaacgaagataaatcatgtcgaaagctacata

taaggaacgtgctgctactcatcctagtcctgttgctgccaagctatttaatatcatgcacgaaaagcaaacaaacttgt

gtgcttcattggatgttcgtaccaccaaggaattactggagttagttgaagcattaggtcccaaaatttgtttactaaaa

acacatgtggatatcttgactgatttttccatggagggcacagttaagccgctaaaggcattatccgccaagtacaattt

tttactcttcgaagacagaaaatttgctgacattggtaatacagtcaaattgcagtactctgcgggtgtatacagaatag

cagaatgggcagacattacgaatgcacacggtgtggtgggcccaggtattgttagcggtttgaagcaggcggcagaagaa

gtaacaaaggaacctagaggccttttgatgttagcagaattgtcatgcaagggctccctatctactggagaatatactaa

gggtactgttgacattgcgaagagcgacaaagattttgttatcggctttattgctcaaagagacatgggtggaagagatg

aaggttacgattggttgattatgacacccggtgtgggtttagatgacaagggagacgcattgggtcaacagtatagaacc

gtggatgatgtggtctctacaggatctgacattattattgttggaagaggactatttgcaaagggaagggatgctaaggt

agagggtgaacgttacagaaaagcaggctgggaagcatatttgagaagatgcggccagcaaaactaaaaaactgtattat

aagtaaatgcatgtatactaaactcacaaattagagcttcaatttaattatatcagttattacccgggaatctcggtcgt

aatgatttttataatgacgaaaaaaaaaaaattggaaagaaaaagctttaatgcggtagtttatcacagttaaattgcta

acgcagtcaggcaccgtgtatgaaatctaacaatgcgctcatcgtcatcctcggcaccgtcaccctggatgctgtaggca

taggcttggttatgccggtactgccgggcctcttgcgggatatcgtccattccgacagcatcgccagtcactatggcgtg

ctgctagcgctatatgcgttgatgcaatttctatgcgcacccgttctcggagcactgtccgaccgctttggccgccgccc

agtcctgctcgcttcgctacttggagccactatcgactacgcgatcatggcgaccacacccgtcctgTggatcttccagt

ggtgcatgaacgcatgagaaagcccccggaagatcatcttccgggggctttttttttggcgcgcgatacagaccggttca

gacaggataaagaggaacgcagaatgttagacaacacccgcttacgcatagctattcagaaatcaggccgtttaagcgat

gattcacgagaattgctggcccgctgcggcataaaaattaatttacacactcagcgcctgattgcgatggcggaaaacat

gccgattgatatcctgcgcgtgcgtgatgatgacattccgggtctggtaatggatggcgtggtcgatctcggtattatcg

gcgaaaacgtgctggaagaagagctactcaaccgccgcgcacagggcgaagatccacgctatttaaccctgcgccgtctt

gacttcggcggctgccgtttatcgctggcaacaccggttgacgaagcctgggacggcccggccgcgctggacggtaaacg

tatcgctacctcatatccgcacctcctcaaacgctacctcgaccagaaaggcgtctcttttaaatcgtgtctgttaaatg

gttctgtcgaagtcgcgccgcgcgcggggctggccgacgctatctgcgatttggtctctaccggcgcgacgcttgaagct

aacggcctgcgtgaagtcgaagttatctaccgctctaaagcctgtctgattcagcgcgacggtgagatggcacagagcaa

gcaagagctgatcgataaattgctgacccgtattcagggcgtgattcaggcgcgcgaatcgaaatacatcatgatgcacg

cgccaagtgaacgcctggaagaggttatcgccctgctgccaggcgccgaaaggccgacaattctgccgctggcaggcgag

caacagcgcgtggcgatgcacatggtcagcagcgaaacgttgttctgggaaaccatggagaaactgaaagcgcttggcgc

cagctcgattctggtactgccgatcgagaagatgatggagtgatctgacgcctgatggcgctgcgcttatcaggcctacg

taatgcgttgatattttgggttctgtaggccggataaggcggaaccctgtgatggagtaaagaccatgagcttcaatacc

ctgattgactggaacagggatccTctacgccggacgcatcgtggccggcatcaccggcgccacaggtgcggttgctggcg

cctatatcgccgacatcaccgatggggaagatcgggctcgccacttcgggctcatgagcgcttgtttcggcgtgggtatg

gtggcaggccccgtggccgggggactgttgggcgccatctccttgcatgcaccattccttgcggcggcggtgctcaacgg

cctcaacctactactgggctgcttcctaatgcaggagtcgcataagggagagcgtcgaccgatgcccttgagagccttca

acccagtcagctccttccggtgggcgcggggcatgactatcgtcgccgcacttatgactgtcttctttatcatgcaactc

gtaggacaggtgccggcagcgctctgggtcattttcggcgaggaccgctttcgctggagcgcgacgatgatcggcctgtc

gcttgcggtattcggaatcttgcacgccctcgctcaagccttcgtcactggtcccgccaccaaacgtttcggcgagaagc

aggccattatcgccggcatggcggccgacgcgctgggctacgtcttgctggcgttcgcgacgcgaggctggatggccttc

cccattatgattcttctcgcttccggcggcatcgggatgcccgcgttgcaggccatgctgtccaggcaggtagatgacga

ccatcagggacagcttcaaggatcgctcgcggctcttaccagcctaacttcgatcactggaccgctgatcgtcacggcga

tttatgccgcctcggcgagcacatggaacgggttggcatggattgtaggcgccgccctataccttgtctgcctccccgcg

ttgcgtcgcggtgcatggagccgggccacctcgacctgaatggaagccggcggcacctcgctaacggattcaccactcca

agaattggagccaatcaattcttgcggagaactgtgaatgcgcaaaccaacccttggcagaacatatccatcgcgtccgc

catctccagcagccgcacgcggcgcatctcgggcagcgttgggtcctggccacgggtgcgcatgatcgtgctcctgtcgt

tgaggacccggctaggctggcggggttgccttactggttagcagaatgaatcaccgatacgcgagcgaacgtgaagcgac

tgctgctgcaaaacgtctgcgacctgagcaacaacatgaatggtcttcggtttccgtgtttcgtaaagtctggaaacgcg

gaagtcagcgccctgcaccattatgttccggatctgcatcgcaggatgctgctggctaccctgtggaacacctacatctg

tattaacgaagcgctggcattgaccctgagtgatttttctctggtcccgccgcatccataccgccagttgtttaccctca

caacgttccagtaaccgggcatgttcatcatcagtaacccgtatcgtgagcatcctctctcgtttcatcggtatcattac

ccccatgaacagaaattcccccttacacggaggcatcaagtgaccaaacaggaaaaaaccgcccttaacatggcccgctt

tatcagaagccagacattaacgcttctggagaaactcaacgagctggacgcggatgaacaggcagacatctgtgaatcgc

ttcacgaccacgctgatgagctttaccgcagctgcctcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcag

ctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttgg

cgggtgtcggggcgcagccatgacccagtcacgtagcgatagcggagtgtatactggcttaactatgcggcatcagagca

gattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgctctt

ccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaata

cggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaa

ggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggc

gaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccg

cttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttc

ggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaact

atcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgagg

tatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgc

tctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtt

tttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgac

gctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaa

ttaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgagg

cacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggag

ggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaacca

gccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaag

ctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctgcaggcatcgtggtgtcacgctcgtcg

tttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggt

tagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcata

attctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgt

atgcggcgaccgagttgctcttgcccggcgtcaacacgggataataccgcgccacatagcagaactttaaaagtgctcat

cattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtg

cacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggca


Lab Home  |  People  |  Research Summary  |  Bibliography  |  Links  |  Protocols

post<4XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXcate ֕<4L Wy)x(ucat @֕<4L Wy)x(uaux GSURL?http://www.sacs.ucsf.edu/home/HerskowitzLab/protocols/cyc1.html